If you just want to trim a 3’ adapter, the basic command-line for cutadapt is:
cutadapt -a AACCGGTT -o output.fastq input.fastq
The sequence of the adapter is given with the -a option. Of course, you need to replace AACCGGTT with your actual adapter sequence. Reads are read from the input file input.fastq and written to the output file output.fastq.
Cutadapt searches for the adapter in all reads and removes it when it finds it. All reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed entirely (because the adapter was found in the very beginning) are output. All of this can be changed with command-line options, explained further down.
A report is printed after cutadapt has finished processing the reads.
Input files for cutadapt need to be in one the these formats:
The latter format is (or was) used for colorspace data from the SOLiD instruments.
The input file format is recognized from the file name extension (given in parentheses in the list above). You can also explicitly specify which format the input has by using the --format option.
The output format is the same as the input format, except for the FASTA/QUAL pairs – those will always be converted to FASTQ. Also, cutadapt does not check the output file name: If you input FASTQ data, but use -o output.fasta, then the output file will actually be in FASTQ format.
Cutadapt supports compressed input and output files. Whether an input file needs to be decompressed or an output file needs to be compressed is detected automatically by inspecting the file name: If it ends in .gz, then gzip compression is assumed. You can therefore run cutadapt like this and it works as expected:
cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz
Note that the all of cutadapt’s options that expect a file name support this.
If your Python installation includes support for bzip2 compression, then bzip2-compressed files are also supported and recognized by their extension .bz2.
(If you are interested in LZMA compression (.xz and .lzma), contact me.)
If no output file is specified via the -o option, then the output is sent to the standard output stream. Instead of the example command line from above, you can therefore also write:
cutadapt -a AACCGGTT input.fastq > output.fastq
There is one difference in behavior if you use cutadapt without -o: The report is sent to the standard error stream instead of standard output. You can redirect it to a file like this:
cutadapt -a AACCGGTT input.fastq > output.fastq 2> report.txt
Anywhere cutadapt expects a file name, you can also write a dash (-) in order to specify that standard input or output should be used. For example:
tail -n 4 input.fastq | cutadapt -a AACCGGTT - > output.fastq
The tail -n 4 prints out only the last four lines of input.fastq, which are then piped into cutadapt. Thus, cutadapt will work only on the last read in the input file.
In most cases, you should probably use - at most once for an input file and at most once for an output file, in order not to get mixed output.
You cannot combine - and gzip compression since cutadapt needs to know the file name of the output or input file. if you want to have a gzip-compressed output file, use -o with an explicit name.
One last “trick” is to use /dev/null as an output file name. This special file discards everything you send into it. If you only want to see the statistics output, for example, and do not care about the trimmed reads at all, you could use something like this:
cutadapt -a AACCGGTT -o /dev/null input.fastq
Cutadapt supports trimming of four different kinds of adapters:
Adapter type | Command-line option |
---|---|
3’ adapter | -a ADAPTER |
5’ adapter | -g ADAPTER |
Anchored 5’ adapter | -g ^ADAPTER |
5’ or 3’ (both possible) | -b ADAPTER |
Here is an illustration of the allowed adapter locations relative to the read and depending on the adapter type:
By default, all adapters are searched error-tolerantly. Adapter sequences may also contain the “N” wildcard character.
In addition, it is possible to remove a fixed number of bases from the beginning or end of each read, and to remove low-quality bases (quality trimming) from the 3’ end of each read.
A 3’ adapter is a piece of DNA ligated to the 3’ end of the DNA fragment you are interested in. The sequencer starts the sequencing process at the 5’ end of the fragment and sequences into the adapter if the read is long enough. The read that it outputs will then have a part of the adapter in the end. Or, if the adapter was short and the read length quite long, then the adapter will be somewhere within the read (followed by other bases).
For example, assume your fragment of interest is MYSEQUENCE and the adapter is ADAPTER. Depending on the read length, you will get reads that look like this:
MYSEQUEN
MYSEQUENCEADAP
MYSEQUENCEADAPTER
MYSEQUENCEADAPTERSOMETHINGELSE
Use cutadapt’s -a ADAPTER option to remove this type of adapter. This will be the result:
MYSEQUEN
MYSEQUENCE
MYSEQUENCE
MYSEQUENCE
As can be seen, cutadapt correctly deals with partial adapter matches, and also with any trailing sequences after the adapter. Cutadapt deals with 3’ adapters by removing the adapter itself and any sequence that may follow. If the sequence starts with an adapter, like this:
ADAPTERSOMETHING
Then the sequence will be empty after trimming. Note that, by default, empty reads are not discarded and will appear in the output.
Note
Unless your adapter may also occur in a degraded form, you probably want to use an anchored 5’ adapter, described in the next section.
A 5’ adapter is a piece of DNA ligated to the 5’ end of the DNA fragment of interest. The adapter sequence is expected to appear at the start of the read, but may be partially degraded. The sequence may also appear somewhere within the read. In all cases, the adapter itself and the sequence preceding it is removed.
Again, assume your fragment of interest is MYSEQUENCE and the adapter is ADAPTER. The reads may look like this:
ADAPTERMYSEQUENCE
DAPTERMYSEQUENCE
TERMYSEQUENCE
SOMETHINGADAPTERMYSEQUENCE
All the above sequences are trimmed to MYSEQUENCE when you use -g ADAPTER. As with 3’ adapters, the resulting read may have a length of zero when the sequence ends with the adapter. For example, the read
SOMETHINGADAPTER
will be empty after trimming.
In many cases, the above behavior is not really what you want for trimming 5’ adapters. You may know, for example, that degradation does not occur and that the adapter is also not expected to be within the read. Thus, you always expect the read to look like the first example from above:
ADAPTERSOMETHING
If you want to trim only this type of adapter, use -g ^ADAPTER. The ^ is supposed to indicate the the adapter is “anchored” at the beginning of the read. In other words: The adapter is expected to be a prefix of the read. Note that cases like these are also recognized:
ADAPTER
ADAPT
ADA
The read will simply be empty after trimming.
Be aware that cutadapt still searches for adapters error-tolerantly and, in particular, allows insertions. So if your maximum error rate is sufficiently high, even this read will be trimmed:
BADAPTERSOMETHING
The B in the beginnig is seen as an insertion. If you also want to prevent this from happening, use the option --no-indels to disallow insertions and deletions entirely.
The last type of adapter is a combination of the 5’ and 3’ adapter. You can use it when your adapter is ligated to the 5’ end for some reads and to the 3’ end in other reads. This probably does not happen very often, and this adapter type was in fact originally implemented because the library preparation in an experiment did not work as it was supposed to.
For this type of adapter, the sequence is specified with -b ADAPTER (or use the longer spelling --anywhere ADAPTER). The adapter may appear in the beginning (even degraded), within the read, or at the end of the read (even partially). The decision which part of the read to remove is made as follows: If there is at least one base before the found adapter, then the adapter is considered to be a 3’ adapter and the adapter itself and everything following it is removed. Otherwise, the adapter is considered to be a 5’ adapter and it is removed from the read, but the sequence after it it remains.
Here are some examples.
Read before trimming | Read after trimming | Detected adapter type |
---|---|---|
MYSEQUENCEADAPTERSOMETHING | MYSEQUENCE | 3’ adapter |
MYSEQUENCEADAPTER | MYSEQUENCE | 3’ adapter |
MYSEQUENCEADAP | MYSEQUENCE | 3’ adapter |
MADAPTER | M | 3’ adapter |
ADAPTERMYSEQUENCE | MYSEQUENCE | 5’ adapter |
PTERMYSEQUENCE | MYSEQUENCE | 5’ adapter |
TERMYSEQUENCE | MYSEQUENCE | 5’ adapter |
The -b option currently does not work with colorspace data.
All searches for adapter sequences are error tolerant. Allowed errors are mismatches, insertions and deletions. For example, if you search for the adapter sequence ADAPTER and the error tolerance is set appropriately (as explained below), then also ADABTER will be found (with 1 mismatch), as well as ADAPTR (with 1 deletion), and also ADAPPTER (with 1 insertion).
The level of error tolerance is adjusted by specifying a maximum error rate, which is 0.1 (=10%) by default. Use the -e option to set a different value. To determine the number of allowed errors, the maximum error rate is multiplied by the length of the match (and then rounded off).
What does that mean? Assume you have a long adapter LONGADAPTER and it appears in full somewhere within the read. The length of the match is 11 characters since the full adapter has a length of 11, therefore 11·0.1=1.1 errors are allowed with the default maximum error rate of 0.1. This is rounded off to 1 allowed error. So the adapter will be found within this read:
SEQUENCELONGADUPTERSOMETHING
If the match is a bit shorter, however, the result is different:
SEQUENCELONGADUPT
Only 9 characters of the adapter match: LONGADAPT matches LONGADUPT with one substitution. Therefore, only 9·0.1=0.9 errors are allowed. Since this is rounded off to zero allowed errors, the adapter will not be found.
The number of errors allowed for a given adapter match length is also shown in the report that cutadapt prints:
Sequence: 'LONGADAPTER'; Length: 11; Trimmed: 2 times.
No. of allowed errors:
0-9 bp: 0; 10-11 bp: 1
This tells us what we now already know: For match lengths of 0-9 bases, zero errors are allowed and for matches of length 10-11 bases, one error is allowed.
The reason for this behavior is to ensure that short matches are not favored unfairly. For example, assume the adapter has 40 bases and the maximum error rate is 0.1, which means that four errors are allowed for full-length matches. If four errors were allowed even for a short match such as one with 10 bases, this would mean that the error rate for such a case is 40%, which is clearly not what was desired.
Insertions and deletions can be disallowed by using the option --no-indels.
See also the section on details of the alignment algorithm.
Since cutadapt allows partial matches between the read and the adapter sequence, short matches can occur by chance, leading to erroneously trimmed bases. For example, roughly 25% of all reads end with a base that is identical to the first base of the adapter. To reduce the number of falsely trimmed bases, the alignment algorithm requires that at least three bases match between adapter and read. The minimum overlap length can be changed with the --overlap``(short: ``-O) parameter. Shorter matches are simply ignored, and the bases are not trimmed.
Requiring at least three bases to match is quite conservative. Even if no minimum overlap was required, we can compute that we lose only about 0.44 bases per read on average, see `Section 2.3.3 in my thesis <<http://hdl.handle.net/2003/31824>`_. With the default minimum overlap length of 3, only about 0.07 bases are lost per read.
When choosing an appropriate minimum overlap length, take into account that true adapter matches are also lost when the overlap length is higher than 1, reducing cutadapt’s sensitivity.
The wildcard character N in the adapter sequence is supported. It matches any nucleotide. This is useful for trimming adapters that have a variable barcode embedded in them:
cutadapt -a ACGTAANNNNTTAGC -o output.fastq input.fastq
Wildcard characters in the reads are also supported, but this must be enabled with --match-read-wildcards.
By using the --cut option or its abbreviation -u, it is possible to unconditionally remove bases from the beginning or end of each read. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end.
For example, to remove the first five bases of each read:
cutadapt -u 5 -o trimmed.fastq reads.fastq
To remove the last seven bases of each read:
cutadapt -u -7 -o trimmed.fastq reads.fastq
The -u/--cut option can be combined with the other options, but the desired bases are removed before any adapter trimming.
The -q (or --trim-qualities) parameter can be used to trim low-quality ends from reads before adapter removal. For this to work correctly, the quality values must be encoded as ascii(phred quality + 33). If they are encoded as ascii(phred quality + 64), you need to add --quality-base=64 to the command line.
The trimming algorithm is the same as the one used by BWA. That is: Subtract the given cutoff from all qualities; compute partial sums from all indices to the end of the sequence; cut sequence at the index at which the sum is minimal.
Quality trimming can be done without adapter trimming, so this will work:
cutadapt -q 10 -o output.fastq input.fastq
Cutadapt supports trimming of paired-end reads, but currently two passes over the data are required.
Assume the input is in reads.1.fastq and reads.2.fastq and that ADAPTER_FWD should be trimmed from the forward reads (first file) and ADAPTER_REV from the reverse reads (second file).
If you do not use any of the filtering options that discard reads, such as --discard, --minimum-length or --maximum-length, then run cutadapt on each file separately:
cutadapt -a ADAPTER_FWD -o trimmed.1.fastq reads1.fastq
cutadapt -a ADAPTER_REV -o trimmed.2.fastq reads2.fastq
You can use the options that are listed under ‘Additional modifications’ in cutadapt’s help output without problems. For example, if you want to quality-trim the first read in each pair with a threshold of 10, and the second read in each pair with a threshold of 15, then the commands could be:
cutadapt -q 10 -a ADAPTER_FWD -o trimmed.1.fastq reads1.fastq
cutadapt -q 15 -a ADAPTER_REV -o trimmed.2.fastq reads2.fastq
However, if you use one of the filtering options that discard reads, then you need to give both input read files to cutadapt and the --paired-output option is needed to keep the two files synchronized. First trim the forward read, writing output to temporary files (we also add some quality trimming):
cutadapt -q 10 -a ADAPTER_FWD --minimum-length 20 -o tmp.1.fastq -p tmp.2.fastq reads.1.fastq reads.2.fastq
The -p is an abbreviation for --paired-output. Then trim the reverse read, using the temporary files as input:
cutadapt -q 15 -a ADAPTER_REV --minimum-length 20 -o trimmed.2.fastq -p trimmed.1.fastq tmp.2.fastq tmp.1.fastq
Finally, remove the temporary files:
rm tmp.1.fastq tmp.2.fastq
In each call to cutadapt, the read-modifying options such as -q only apply to the first file (first reads.1.fastq, then tmp.2.fastq in this example). Reads in the second file are not affected by those options, but by the filtering options: If a read in the first file is discarded, then the matching read in the second file is also filtered and not written to the output given by --paired-output in order to keep both output files synchronized.
When you use -p/--paired-output, then cutadapt also checks whether the files are properly paired. An error is raised if one of the files contains more reads than the other or if the read names in the two files do not match. Only the part of the read name before the first space is considered. If the read name ends with /1 or /2, then that is also ignored. For example, two FASTQ headers that would be considered to denote properly paired reads are:
@my_read/1 a comment
and:
@my_read/2 another comment
It is possible to specify more than one adapter sequence by using the options -a, -b and -g more than once. Any combination is allowed, such as five -a adapters and two -g adapters. Each read will be searched for all given adapters, but only the best matching adapter is removed. (But it is possible to trim more than one adapter from each read). This is how a command may look like to trim one of two possible 3’ adapters:
cutadapt -a TGAGACACGCA -a AGGCACACAGGG -o output.fastq input.fastq
The adapter sequences can also be read from a FASTA file. Instead of giving an explicit adapter sequence, you need to write file: followed by the name of the FASTA file:
cutadapt -a file:adapters.fasta -o output.fastq input.fastq
All of the sequences in the file adapters.fasta will be used as 3’ adapters. The other adapter options -b and -g also support this. Again, only the best matching adapter is trimmed from each read.
When cutadapt has multiple adapter sequences to work with, either specified explicitly on the command line or via a FASTA file, it decides in the following way which adapter should be trimmed:
If your adapter sequences are all similar and differ only by a variable barcode sequence, you should use a single adapter sequence instead that contains wildcard characters.
Cutadapt reports statistics for each adapter separately. To identify the adapters, they are numbered and the adapter sequence is also printed:
=== Adapter 1 ===
Sequence: AACCGGTT; Length 8; Trimmed: 5 times.
If you want this to look a bit nicer, you can give each adapter a name in this way:
cutadapt -a My_Adapter=AACCGGTT -o output.fastq input.fastq
The actual adapter sequence in this example is AACCGGTT and the name assigned to it is My_Adapter. The report will then contain this name in addition to the other information:
=== Adapter 'My_Adapter' ===
Sequence: TTAGACATATCTCCGTCG; Length 18; Trimmed: 5 times.
When adapters are read from a FASTA file, the sequence header is used as the adapter name.
Adapter names are also used in column 8 of info files.
By default, at most one adapter sequence is removed from each read, even if multiple adapter sequences were provided. This can be changed by using the --times option (or its abbreviated form -n). Cutadapt will then search for all the given adapter sequences repeatedly, either until no adapter match was found or until the specified number of rounds was reached.
As an example, assume you have a protocol in which a 5’ adapter gets ligated to your DNA fragment, but it’s possible that the adapter is ligated more than once. So your sequence could look like this:
ADAPTERADAPTERADAPTERMYSEQUENCE
To be on the safe side, you assume that there are at most 5 copies of the adapter sequence. This command can be used to trim the reads correctly:
cutadapt -g ^ADAPTER -n 5 -o output.fastq input.fastq
This feature can also be used to search for 5’/3’ linked adapters. For example, when the 5’ adapter is FIRST and the 3’ adapter is SECOND, then the read could look like this:
FIRSTMYSEQUENCESECOND
That is, the sequence of interest is framed by the 5’ and the 3’ adapter. The following command can be used to trim such a read:
cutadapt -g ^FIRST -a SECOND -n 2 ...
Support for linked adapters is currently incomplete. For example, it is not possible to specify that SECOND should only be trimmed when FIRST also occurs. See also this feature request, and comment on it if you would like to see this implemented.
If you have reads containing Illumina TruSeq adapters, follow these steps.
Trim read 1 with A + the “TruSeq Indexed Adapter”. Use only the prefix of the adapter sequence that is common to all Indexed Adapter sequences:
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o trimmed.1.fastq.gz reads.1.fastq.gz
Trim read 2 with the reverse complement of the “TruSeq Universal Adapter”:
cutadapt -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o trimmed.2.fastq.gz reads.2.fastq.gz
See also the section about paired-end adapter trimming above.
If you want to simplify this a bit, you can also use the common prefix AGATCGGAAGAGC as the adapter sequence in both cases:
cutadapt -a AGATCGGAAGAGC -o trimmed.1.fastq.gz reads.1.fastq.gz
cutadapt -a AGATCGGAAGAGC -o trimmed.2.fastq.gz reads.2.fastq.gz
The adapter sequences can be found in the document Illumina TruSeq Adapters De-Mystified.
When trimming reads that come from a library prepared with the RRBS (reduced representation bisulfit sequencing) protocol, the last two 3’ bases must be removed in addition to the adapter itself. This can be achieved by using not the adapter sequence itself, but by adding two wildcard characters to its beginning. If the adapter sequence is ADAPTER, the command for trimming should be:
cutadapt -a NNADAPTER -o output.fastq input.fastq
Details can be found in Babraham bioinformatics’ “Brief guide to RRBS”. A summary follows.
During RRBS library preparation, DNA is digested with the restriction enzyme MspI, generating a two-base overhang on the 5’ end (CG). MspI recognizes the sequence CCGG and cuts between C and CGG. A double-stranded DNA fragment is cut in this way:
5'-NNNC|CGGNNN-3'
3'-NNNGGC|CNNN-5'
The fragment between two MspI restriction sites looks like this:
5'-CGGNNN...NNNC-3'
3'-CNNN...NNNGGC-5'
Before sequencing (or PCR) adapters can be ligated, the missing base positions must be filled in with GTP and CTP:
5'-ADAPTER-CGGNNN...NNNCcg-ADAPTER-3'
3'-ADAPTER-gcCNNN...NNNGGC-ADAPTER-5'
The filled-in bases, marked in lowercase above, do not contain any original methylation information, and must therefore not be used for methylation calling. By prefixing the adapter sequence with NN, the bases will be automatically stripped during adapter trimming.
By default, all processed reads, no matter whether they were trimmed are not, are written to the output file specified by the -o option (or to standard output if -o was not provided). For paired-end reads, the second read in a pair is always written to the file specified by the -p option.
The options described in the following make it possible to redirect the reads to other files depending on their length and depending on whether they were trimmed or not. However, the basic rule here is that each read is written to at most one file. You cannot write reads to more than one output file.
In the following, the term “processed read” refers to a read which has been quality trimmed (if -q has been used) and in which all found adapters have been removed. A processed read may be identical with the input read if no bases were quality-trimmed and no adapters were found.
The options --too-short-output and --too-long-output are applied first. This means, for example, that a read that is too long will never end up in the --untrimmed-output file when --too-long-output was given, no matter whether it was trimmed or not.
The following options apply only when trimming paired-end data.
Note that the option names can be abbreviated as long as it is clear which option is meant (unique prefix). For example, instead of --untrimmed-output and --untrimmed-paired-output, you can write --untrimmed-o and --untrimmed-p.
After every run, cutadapt prints out per-adapter statistics. The output starts with something like this:
Sequence: 'ACGTACGTACGTTAGCTAGC'; Length: 20; Trimmed: 2402 times.
The meaning of this should be obvious.
The next piece of information is this:
No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20 bp: 2
The adapter has, as was shown above, has a length of 20 characters. We are using the default error rate of 0.1. What this implies is shown above: Matches up to a length of 9 bp are allowed to have no errors. Matches of lengths 10-19 bp are allowd to have 1 error and matches of length 20 can have 2 errors. See also the section about error-tolerant matching.
Finally, a table is output that gives more detailed information about the lengths of the removed sequences. The following is only an excerpt; some rows are left out:
Overview of removed sequences
length count expect max.err error counts
3 140 156.2 0 140
4 57 39.1 0 57
5 50 9.8 0 50
6 35 2.4 0 35
...
100 397 0.0 3 358 36 3
The first row tells us the following: Three bases were removed in 140 reads; randomly, one would expect this to occur 156.2 times; the maximum number of errors at that match length is 0 (this is actually redundant since we know already that no errors are allowed at lengths 0-9 bp).
The last column shows the number of reads that had 0, 1, 2 ... errors. In the last row, for example, 358 reads matched the adapter with zero errors, 36 with 1 error, and 3 matched with 2 errors.
The “expect” column gives only a rough estimate of the number of sequences that is expected to match randomly (it assumes a GC content of 50%, for example), but it can help to estimate whether the matches that were found are true adapter matches or if they are due to chance. At lengths 6, for example, only 2.4 reads are expected, but 35 do match, which hints that most of these matches are due to actual adapters.
Note that the “length” column refers to the length of the removed sequence. That is, the actual length of the match in the above row at length 100 is 20 since that is the adapter length. Assuming the read length is 100, the adapter was found in the beginning of 397 reads and therefore those reads were trimmed to a length of zero.
The table may also be useful in case the given adapter sequence contains an error. In that case, it may look like this:
...
length count expect max.err error counts
10 53 0.0 1 51 2
11 45 0.0 1 42 3
12 51 0.0 1 48 3
13 39 0.0 1 0 39
14 40 0.0 1 0 40
15 36 0.0 1 0 36
...
We can see that no matches longer than 12 have zero errors. In this case, it indicates that the 13th base of the given adapter sequence is incorrect.
When the --info-file command-line parameter is given, detailed information about the found adapters is written to the given file. The output is a tab-separated text file. Each line corresponds to one read of the input file. The fields are:
The concatenation of the fields 5-7 yields the full read sequence. Column 8 identifies the found adapter. The section about named adapters <named-adapters> describes how to give a name to an adapter. Adapters without a name are numbered starting from 1.
If no adapter was found, the format is as follows:
When parsing that file, be aware that additional columns may be added in the future. Note also that some fields can be empty, resulting in consecutive tabs within a line. Also, in the current version, when the --times option is set to a value other than 1 (the default value), multiple lines are written to the info file for each read.
Since the publication of the EMBnet journal application note about cutadapt, the alignment algorithm used for finding adapters has changed significantly. An overview of this new algorithm is given in this section. An even more detailed description is available in Chapter 2 of my PhD thesis Algorithms and tools for the analysis of high-throughput DNA sequencing data.
The algorithm is based on semiglobal alignment, also called free-shift, ends-free or overlap alignment. In a regular (global) alignment, the two sequences are compared from end to end and all differences occuring over that length are counted. In semiglobal alignment, the sequences are allowed to freely shift relative to each other and differences are only penalized in the overlapping region between them:
FANTASTIC
ELEFANT
The prefix ELE and the suffix ASTIC do not have a counterpart in the respective other row, but this is not counted as an error. The overlap FANT has a length of four characters.
Traditionally, alignment scores are used to find an optimal overlap aligment: This means that the scoring function assigns a positive value to matches, while mismatches, insertions and deletions get negative values. The optimal alignment is then the one that has the maximal total score. Usage of scores has the disadvantage that they are not at all intuitive: What does a total score of x mean? Is that good or bad? How should a threshold be chosen in order to avoid finding alignments with too many errors?
For cutadapt, the adapter alignment algorithm uses unit costs instead. Mismatches, insertions and deletions are therefore counted as one error, which is easier to understand and always to specify a single parameter for the algorithm (the maximum error rate) in order to describe how many errors are acceptable.
There is a problem with this: When using costs instead of scores, we would like to minimize the total costs in order to find an optimal alignment. But then the best alignment would always be the one in which the two sequences do not overlap at all! This would be correct, but meaningless for the purpose of finding an adapter sequence.
The optimization criteria are therefore a bit different. The basic idea is to consider the alignment optimal that maximizes the overlap between the two sequences, as long as the allowed error rate is not exceeded.
Conceptually, the procedure is as follows:
In Step 1, the different adapter types are taken into account: Only those overlaps that are actually allowed by the adapter type are actually considered.